Chapter 49 Research


Previous Chapter Table of Content Next Chapter

  Chapter 49:
  Zhang Cishun certainly knows what a qualified person is, but he is not sure whether Ning Jiancheng knows. So he didn't say anything.

  Wenquan slowly explained the information about the qualified candidates to Zhang Cishun. While explaining, he also manipulated the map on the image to enlarge and peel it off.

  "This is a genetic sequence in the body of a qualified person. If you have learned this knowledge, you should be able to understand it." Wenquan said, turning to look at Zhang Cishun.

  Zhang Cishun noticed Wenquan's gaze, but did not turn to look at her. The genetic engineering at level 2 and the biological skills at level 4 allowed him to understand the information in this map, but it was not enough to support his expansion based on the 'knowledge' he had learned.

  But unfortunately, Zhang Cishun had read the file called "Gene Map of Eligible Persons" on the USB flash drive brought back by Zuo Yan.

  There are slight differences between the content of the data and the map in front of you, but genetic engineering and biological technology are fully capable of building a bridge called 'integration'.

  The laboratory was quiet for a long time under the pause of the hot spring's words. It was not until the eyes of other personnel in the room turned to him that Zhang Cishun organized his speech in his mind: "This gene is called ABCD1
  . Or you can call it ALDP. The chromosome location is at 12q25, the base sequence is ATCGATCGAATTGCCAGCTG, and the promoter region is TATAAAACTGAGTA. Normally the length of the complete encoded protein should be 745, but what you show here is abnormal. Than Under normal circumstances, there are more...one hundred.

  Considering that this is the genetic map of a qualified person, these one hundred abnormally encoded proteins should be the target.

  If the normal situation of the one hundred extra encoded proteins is not considered They are highly expressed in liver, kidney, brain and muscle tissue, with a mutation frequency of one in 20,000, often manifesting as missense mutations, nonsense mutations, insertion and deletions, etc." Zhang Cishun explained this clearly

  . The paragraph was narrated. After finishing speaking, he looked back at the other people's eyes: "So what kind of mutation is this?"

  As Zhang Cishun finished his words with obvious doubts, he noticed the two people standing opposite. The researcher withdrew his gaze.

  After Wenquan raised his hand and gave him a thumbs up, he said: "It is not classified as a mutation for the time being. Under normal circumstances, mutations in this section of the genome will manifest as myelin loss, adrenal gland dysfunction, nervous system degeneration and many other symptoms, but With the participation of the extra one hundred coding proteins...all negative mutations have become positive. This can be regarded as optimization, or...evolution." "Understood." Zhang

  Cishun Nod.

  "So what do you need me to do?"

  ...

  Time passed quickly during the experiment, but there was actually little progress in the experimental research. Zhang Cishun's main job today is to be an assistant and not participate in front-line operations.

  Zhang Cishun was also happy with this.

  After it was over,

  Zhang Cishun followed the four people in the hot spring to the locker room.

  When everyone changed their dark green 'surgical clothes' into their previous white research clothes, he noticed that among the five people present, excluding himself, two of the logos behind the four people were INNHBS (Neural Network and Human Brain) Simulation Research Institute), and two are CCGE (Center for Cloning and Genetic Improvement).

  There are two girls from the same institute as Zhang Cishun, including Wenquan, and the two boys are from CCGE.

  There is a window in the locker room. It should have been possible to see the outside scenery from here, but due to the sandstorm, the only color that can be seen now is black.

  When the warm light in the dressing room shines through the window, you can still clearly see the traces of wind and sand.

  While Zhang Cishun was looking at the sandstorm outside the window, two CCGE people came over.

  "Let me meet you. My name is Yang Sheng."

  "Liu Yiwei."

  Zhang Cishun turned his head, pushed up his glasses, and said, "Ning Jiancheng."

  None of the three of them had any intention of shaking hands. Yang grew up with sharp edges and corners. Compared with Yang Sheng, Liu Yiwei was a head shorter and much fatter.

  In this world, being able to gain weight is a very happy thing.

  Liu Yiwei is probably the first fat man Zhang Cishun has seen in a real sense since he came to this world.

  "Were you unhappy just now?" Yang Sheng asked, then he reached into his pocket and took out a sky blue cigarette case.

  After opening it, hand it to Zhang Cishun.

  "Unhappy...when are you referring to?" Zhang Cishun asked.

  Yang Sheng's cigarettes were accepted by Zhang Cishun because Ning Jiancheng was a smoker.

  "When Wenquan asked you about ALDP." Yang Sheng explained: "That question was considered a simple test. Wenquan had no intention of doing this. It was the two of us who thought it was necessary to test your level. Before you came, we and Wenquan I've been talking about this."

  Yang Sheng started lighting the fire as he spoke, and when he passed the fire towards Zhang Cishun, Zhang Cishun pushed his hand and refused.

  Yang Sheng didn't care. After lighting it for himself, he continued: "Our research group is almost ready to produce results. The previous Lao Zhang and several others were transferred away by the superiors, and our group almost stopped. But although There is a shortage of people, but we don't want anyone to be able to come in.

  Originally, this was an internal matter at INN. If someone came in for a flat transfer or something like that, the two of us were actually not prepared to say anything, but... you are in charge From the urban area."

  Although they are both research institutes, there are still differences between Zhongcheng District and Shangcheng District.

  Different pools have different ingredients.

  Zhang Cishun thought for a while and asked, "Then I have passed your assessment now?"

  Yang Sheng said, "For the time being."

  Zhang Cishun thought this person was quite interesting, with obvious hostility, but no malice. It can be seen that Yang Sheng's hostility towards him is just because he is from Zhongcheng District and he is worried that his level is not enough and will hold back the entire research team.

  Zhang Cishun didn't take the assessment to heart. He had almost figured out the research progress of this group now. If he only used his own 'knowledge' to advance the research, he might be a little behind, but still the same sentence. So, Zuo Yan's documents were of great use.

  Perhaps this document cannot help him advance his research, but it should be no problem to cope with the so-called Yang Sheng's assessment.

  After talking about this topic, the three of them had a brief awkward chat and then dispersed.

  Neither Yang Sheng nor Liu Yiwei are eloquent people. Only when they talked about their professional fields, they would talk at length, but other than that...

  Zhang Cishun did not leave with the two of them, but waited until they left before reaching out to take the former Yang Sheng in his hand. The cigarette he was given was passed towards the empty place beside him.

  After a few breaths, the smoke disappeared in his hand.

  ...

  (End of chapter)

Previous Chapter Table of Content Next Chapter